> For the complete documentation index, see [llms.txt](https://emory.gitbook.io/dsa-java/llms.txt). Markdown versions of documentation pages are available by appending `.md` to page URLs; this page is available as [Markdown](https://emory.gitbook.io/dsa-java/dynamic-programming/longest-common-subsequence.md).

# 10.3. Longest Common Subsequence

This section discusses recursive and dynamic programming ways of finding longest common subsequence.

A subsequence is a sequence that can be derived from another sequence by deleting some or no elements without changing the order of the remaining elements.

Given a string "ABCDE"

* Substring: {"A", "BC", "CDE", ...}
* Subsequence: {all substrings, "AC", "ACE", ...}
* Not subsequence: {"BA", "DAB", ...}

Longest common subsequence

* The longest subsequence commonly shared by multiple strings.
* e.g., “baal” is a LCS of “bilabial” and “balaclava”.

> Can there be more than one longest common subsequence?

Application

* Find the longest common subsequence in DNA (e.g., `GAATGTCCTTTCTCTAAGTCCTAAG`).

## Abstraction

Let us create the abstract class [`LCS`](https://github.com/emory-courses/dsa-java/blob/master/src/main/java/edu/emory/cs/dynamic/lcs/LCS.java):

```java
public abstract class LCS {
    /**
     * @param a the first string.
     * @param b the second string.
     * @return a longest common sequence of the two specific strings.
     */
    public String solve(String a, String b) {
        return solve(a.toCharArray(), b.toCharArray(), a.length() - 1, b.length() - 1);
    }

    /**
     * @param c the first array of characters.
     * @param d the second array of characters.
     * @param i the index of the character in {@code c} to be compared.
     * @param j the index of the character in {@code d} to be compared.
     * @return a longest common sequence of the two specific strings.
     */
    protected abstract String solve(char[] c, char[] d, int i, int j);
}
```

## Recursion

Let us create the [`LCSRecursive`](https://github.com/emory-courses/dsa-java/blob/master/src/main/java/edu/emory/cs/dynamic/lcs/LCSRecursive.java) inheriting `LCS`:

```java
public class LCSRecursive extends LCS {
    @Override
    protected String solve(char[] c, char[] d, int i, int j) {
        if (i < 0 || j < 0) return "";
        if (c[i] == d[j]) return solve(c, d, i - 1, j - 1) + c[i];

        String c1 = solve(c, d, i - 1, j);
        String d1 = solve(c, d, i, j - 1);
        return (c1.length() > d1.length()) ? c1 : d1;
    }
}
```

* `L4`: no character is left to compare for either string.
* `L5`: when two characters match, move onto `c[:i-1]` and `d[:j-1]`.&#x20;
* `L7`: gets the longest common subsequence between `c[:i-1]` and `d[:j]`.
* `L8`: gets the longest common subsequence between `c[:i]` and `d[:j-1]`.
* `L9`: returns the longest subsequence.

The followings demonstrate a recursive way of finding a LCS between two strings:

{% embed url="<https://www2.slideshare.net/jchoi7s/dynamic-programming-longest-common-subsequence-recurisve>" %}

## Dynamic Programming

Let us create the [`LCSDynamic`](https://github.com/emory-courses/dsa-java/blob/master/src/main/java/edu/emory/cs/dynamic/lcs/LCSDynamic.java) class inheriting `LCS`.

```java
public class LCSDynamic extends LCS {
    @Override
    protected String solve(char[] c, char[] d, int i, int j) {
        return solve(c, d, i, j, createTable(c, d));
    }

    /**
     * @param c the first string.
     * @param d the second string.
     * @return the dynamic table populated by estimating the # of LCSs in the grid of the two specific strings.
     */
    protected int[][] createTable(char[] c, char[] d) {
        final int N = c.length, M = d.length;
        int[][] table = new int[N][M];

        for (int i = 1; i < N; i++)
            for (int j = 1; j < M; j++)
                table[i][j] = (c[i] == d[j]) ? table[i - 1][j - 1] + 1 : Math.max(table[i - 1][j], table[i][j - 1]);

        return table;
    }
}
```

* `L4`: creates a dynamic table and passes it to the solver.
* `L12`: the dynamic table is pre-populated before any recursive calls.

The following show the dynamic table populated by the previous example:

{% embed url="<https://www2.slideshare.net/jchoi7s/dynamic-programming-longest-common-subsequence-dynamic-table>" %}

Let us define the `solve()` method:

```java
protected String solve(char[] c, char[] d, int i, int j, int[][] table) {
    if (i < 0 || j < 0) return "";
    if (c[i] == d[j])  return solve(c, d, i - 1, j - 1, table) + c[i];
    
    if (i == 0) return solve(c, d, i, j - 1, table);
    if (j == 0) return solve(c, d, i - 1, j, table);
    return (table[i - 1][j] > table[i][j - 1]) ? solve(c, d, i - 1, j, table) : solve(c, d, i, j - 1, table);
}
```

* `L2`: no character is left to compare for either string.
* `L3`: when two characters match, move onto `c[:i-1]` and `d[:j-1]`.&#x20;
* `L5`: gets the longest common subsequence between `c[:i]` and `d[:j-1]`.
* `L6`: gets the longest common subsequence between `c[:i-1]` and `d[:j]`.
* `L9`: returns the longest subsequence by looking up the values in the dynamic table.

The followings demonstrate how to find a LCS using the dynamic table:

{% embed url="<https://www2.slideshare.net/jchoi7s/dynamic-programming-longest-common-subsequence-dynamic-programming>" %}
